Objective The aim of this study was to investigate the role of ubiquitin C\terminal hydrolase\L1 (UCHL1) for motor neuron circuitry and especially in spinal motor neuron (SMN) health, function, and connectivity. with findings in patients with mutations in gene, our results suggest a unique role of UCHL1, especially for motor neuron circuitry. SMN require UCHL1 to maintain NMJ and motor axon health, and that observed motor dysfunction in the absence of UCHL1 is not due to SMN loss, but mostly due to disintegrated circuitry. Introduction To date five different patients are identified with mutations in their ubiquitin C\terminal hydrolase\L1 (UCHL1) gene. The first two patients displayed Parkinson\like symptoms, with defects in their motor function and spasticity in the legs.1 Recently, three siblings with very early neurodegeneration associated with upper motor neuron dysfunction were Mouse monoclonal to CD81.COB81 reacts with the CD81, a target for anti-proliferative antigen (TAPA-1) with 26 kDa MW, which ia a member of the TM4SF tetraspanin family. CD81 is broadly expressed on hemapoietic cells and enothelial and epithelial cells, but absent from erythrocytes and platelets as well as neutrophils. CD81 play role as a member of CD19/CD21/Leu-13 signal transdiction complex. It also is reported that anti-TAPA-1 induce protein tyrosine phosphorylation that is prevented by increased intercellular thiol levels identified to have Glu7Ala mutation in their gene.2 These VP-16 clinical reports sparked interest in exploring the role of UCHL1 function for motor neuron circuitry and motor neuron diseases, especially the ones in which voluntary movement is impaired. UCHL1 is critically important for protein homeostasis due to its dual hydrolase and ligase functions, by adding or removing ubiquitin to poly\ubiquitin chains.1, 3, 4, 5 This is a unique ability of UCHL1 in maintaining free ubiquitin levels and a central role within the ubiquitin proteasome system (UPS) in neurons.6 Defects in protein turn\over and UPS has been closely associated with motor neuron diseases, and it is suggested that motor neurons heavily depend on the proper function of the VP-16 UPS.7, 8, 9, 10, 11 Therefore, investigating the role of UCHL1, especially for motor neurons, and within the context of motor neuron diseases is important. To date numerous mouse models are developed and they revealed important information about the involvement of UCHL1 in both neurodegeneration and cellular proliferation.12, 13, 14, 15 For example, the UCHL1 knockout mouse with a targeted deletion of the exons 6 through 8 of the UCHL1 gene showed its requirement for the normal structure and function of the neuromuscular junctions (NMJ).12 In line with reports that demonstrate motor dysfunction in Uchl1nm3419 (UCHL1?/?) mice, which lack all UCHL1 function,15 we recently defined a unique importance of UCHL1 for motor neuron circuitry.16 Mice that lacked UCHL1 developed motor dysfunction as early as postnatal day (P) 40, and corticospinal motor neurons (CSMN) displayed an early and profound degeneration with spine loss and disintegration of apical dendrites. However, the role of UCHL1 on the spinal component of motor neuron circuitry remained elusive. To reveal the potential link between UCHL1 function and motor circuitry, we investigated spinal motor neuron (SMN) health and connectivity using electrophysiology, histology and molecular marker expression analysis in healthy as well as diseased mice that lacked all UCHL1 function. Our findings revealed defects in the motor, but not the sensory branch of the femoral nerve and disintegration of NMJ. Interestingly, despite early and profound CSMN degeneration, SMN soma remained intact in the spinal cord. NMJ in soleus, and extensor digitorum longus (EDL) muscles, which are mainly innervated by slow\twitch and fast\twitch SMN, respectively, display profound disintegration in the absence of UCHL1 function. recordings further delineate the early functional defects even when neurons are intact and display no signs of increased endoplasmic reticulum (ER) stress or neuron loss. Altogether, our studies suggest that UCHL1 plays different roles in CSMN and SMN and that circuitry defects are more relevant to developing disease pathologies in the absence of UCHL1. Materials and Methods Mice All animal procedures were approved by Northwestern University Animal Care and Use Committee, and conformed to the standards of the National Institutes of Health. (UCHL1?/?) mice identified by G. Cox at The Jackson Laboratory carry a spontaneous 795 base\pair intragenic deletion that results in the removal of the final 24 base\pair of exon 6 and the first 771 base\pairs of intron 6 15 (Fig. ?(Fig.1C).1C). Heterozygous mice (UCHL1+/?) were viable, fertile, and were bred together to generate UCHL1 deficient (UCHL1?/?) mice. All mice were on the C57BL/6J background. Survival times and motor function defects were comparable between males and females with 100% penetrance. Primers used to determine genotype are UCHL1 forward: tggacggctgtgtgtgctaatg, WT reverse: ctaagggaagggtcttgctcatc, mutant (Mt) reverse: gtcatctacctgaagagagccaag, yielding 668 bp WT and 334 bp Mt PCR products. Figure 1 UCHL1 is expressed in wild\type SMN and is absent in VP-16 UCHL1?/? mice. (A) UCHL1 protein is expressed in SMN (ChAT+ neurons) in the spinal cord. (B) Parallel sections of gastrocnemius muscle from WT mice at P40. UCHL1 (green) colocalizes ….