The sequences of the primers utilized for qRT-PCR analyses were the following. IL6_Forward, ACTCACCTCTTCAGAACGAATTG; IL6_Reverse, CCATCTTTGGAAGGTTCAGGTTG; IL8_Forward, TTTTGCCAAGGAGTGCTAAAGA; IL8_Reverse, AACCCTCTGCACCCAGTTTTC; MMP1_Forward, TTGTGGCCAGAAAACAGAAA; HJB-97 MMP1_Reverse, TTCGGGGAGAAGTGATGTTC; MMP3_Forward, CAATTTCATGAGCAGCAACG; MMP3_Reverse, AGGGATTAATGGAGATGCCC; CXCL1_Forward, CTTCCTCCTCCCTTCTGGTC; CXCL1_Reverse, GAAAGCTTGCCTCAATCCTG; CXCL10_Forward, GCTGATGCAGGTACAGCGT; CXCL10_Reverse, CACCATGAATCAAACTGCGA; EGFR_Forward, AGGCACGAGTAACAAGCTCAC; EGFR_Reverse, ATGAGGACATAACCAGCCACC; IGF-IR_Forward, TCGACATCCGCAACGACTATC; IGF-IR_Reverse, CCAGGGCGTAGTTGTAGAAGAG; INSR_Forward, AAAACGAGGCCCGAAGATTTC; INSR_Reverse, GAGCCCATAGACCCGGAAG; PDGFRB_Forward, AGCACCTTCGTTCTGACCTG; PDGFRB_Reverse, TATTCTCCCGTGTCTAGCCCA; GAPDH_Forward, AAGGTGAAGGTCGGAGTCAA; GAPDH_Reverse, AATGAAGGGGTCATTGATGG. crucial dependencies1,2 and broad spectrum kinase inhibitors like sorafenib provide only modest benefit to hepatocellular carcinoma (HCC) individuals3. Induction of senescence may represent a encouraging strategy for the treatment of malignancy, especially when such pro-senescence therapy is usually combined with a second drug that selectively eliminates senescent cancer cells (senolysis)4,5. Through a kinome-focused genetic screen, we report here that pharmacological inhibition of the DNA replication kinase CDC7 induces senescence selectively in mutant liver malignancy cells. A follow-up chemical screen identified the anti-depressant sertraline as an agent that kills HCC cells rendered senescent by CDC7 inhibition. Sertraline supressed mTOR signalling, and selective drugs targeting this pathway were highly effective in causing apoptotic cell death of CDC7 inhibitor-treated HCC cells. Mechanistically, we report that the feedback re-activation of mTOR signalling following its inhibition6 is usually blocked in CDC7-inhibitor treated cells, leading to sustained mTOR inhibition and cell death. Using multiple liver cancer models, we show that combination of CDC7 and mTOR inhibitors results in dramatic tumour growth inhibition. More generally, our data indicate that exploiting an induced vulnerability could be an effective treatment of liver cancer. The increase in hepatocellular carcinoma (HCC) incidence2, the undruggable nature of HCC mutations and unresponsiveness of these tumours to therapy spotlight the urgency to develop novel therapeutic approaches for this disease7. We as well as others have proposed a one-two punch approach to cancer therapy in which the first drug induces a vulnerability exploited by the second drug4,5. Senescent cells have distinct cellular features, which can confer sensitivity to senolytic brokers8,9. Here we experimentally validate the one-two punch therapy for mutant liver cancers. To identify genes REDD-1 whose inactivation can induce senescence in liver malignancy cells, we employed a CRISPR-Cas9 genetic screen using a lentiviral gRNA library representing all human kinases in Hep3B and Huh7 liver malignancy cells10 (Fig. 1a). We identified 38 kinases required for proliferation (Fig. 1b, Extended Data Fig. 1a, Supplementary Table 1), 14 of which could be inhibited by small molecule compounds (Fig. 1b). We screened compounds targeting these 14 kinases for their ability to induce senescence selectively in liver malignancy cells (Fig. 1c). XL413, a potent inhibitor of the DNA replication kinase CDC711, was most selective in inducing senescence-associated -galactosidase (SA–Gal, a marker of senescence) in Hep3B and Huh7 as compared to non-transformed BJ and RPE-1 human cell lines (Fig. 1c). These findings suggest that CDC7 inhibition could represent a novel senescence-inducing strategy in liver malignancy. Open in a separate window Physique 1 A two-step screen identifies CDC7 as a target for senescence-inducing strategy in liver malignancy.a, Hep3B and Huh7 cells were transduced with a lentiviral kinome gRNA library and three independent replicates were cultured for 14 days (T14). gRNA barcodes from T0 and T14 samples were recovered by PCR and analysed by next generation sequencing. The y axis shows log2-fold change in abundance (ratio of gRNA frequency HJB-97 in T14 sample to that in T0 sample). The x axis depicts the average read-count in HJB-97 the T0 sample. b, 38 common hits (among top 50 most strongly depleted hits in each cell line) were identified by CRISPR screen in Hep3B and Huh7 cells. c, Heatmap indicates the effects of compounds (ten compounds targeting 14 hits identified by CRISPR screen, 5 M for 4 day-treatments) on inducing senescence-associated -galactosidase (SA–Gal) activity in non-transformed cell lines (BJ and RPE-1) and liver malignancy cell lines (Hep3B and Huh7). d, CDC7 mRNA expression in paired tumour and non-tumour tissues from “type”:”entrez-geo”,”attrs”:”text”:”GSE14520″,”term_id”:”14520″GSE14520 cohort (n=213) and TCGA database (n=50). Paired two-sided expression is usually upregulated in tumour tissues relative to paired non-tumour tissues in two liver malignancy cohorts (n=213 and n=50) (Fig. 1d) and this was confirmed at the protein level (Extended Data Fig. 1c). Moreover, in a cohort of 365 HCC patients13 the highest tumour levels of CDC7 mRNA exhibited worst survival (Extended Data Fig. 1d). We treated a panel of non-transformed cells and liver malignancy cell lines with increasing concentrations of XL413. Interestingly, proliferation was impaired in mutated liver malignancy cell lines, while wild-type liver malignancy cell lines (SK-Hep1 and Huh6 cells) and all four non-transformed cell lines displayed no sensitivity to XL413 (Fig. 2a). The XL413-sensitive cell line HepG2 is an outlier in this respect, but carries an mutation, which acts upstream of p53 in the DNA damage response. Importantly, shRNA-mediated mutation status.